EST details — SGN-E8213

Search information 
Request: 8213Match: SGN-E8213
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19749Clone name: cLED-27-N20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C19749 [cLED-27-N20] Trace: SGN-T55654 EST: SGN-E241935 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E8213Length: 555 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E8213 [] (called/trimmed by facility)
CTCGTATGTGTATTGATGACGGTCTCGTTGTTTGCAACTTTGTCGCTCAGGCTTTAAGGAAAGAGCCTTTGACCGTTTATGGTGATGGGAAACAA
ACAAGAAGTTTCCAATTTGTTTCAGATCTGGTTGAAGGCTTAATGCGGTTGATGGAAGGAGAACATGTCGGACCCTTCAACCTCGGAAACCCTGG
TGAATTCACAATGCTTGAACTTGCTAAGGTGGTCCAGGAAACCATTGACCCAAATGCACAGATTGTACACAAACCAAACACAGAAGATGACCCAC
ACAAGCGAAAACCTGATATCTCAAAGGCTAAAGAGTTACTTGGTTGGGAACCGAAAGTGGCTCTTAGAAATGGTTTGCCTATGATGGTTCAAGAC
TTCAGGCAACGTATTTTCGGTGATCACAAAGAAGAAAGTGCAAAGATCACCACAGCTTAATAGAAAAGAAAAGTGTGTTATGTTTGGATATTTGT
TAAACTTGGTAAGGGGTGAAACGCACGCGAAGAAAAGACGACTCTCTTGTGTTGATGTTAGTTTCAAGCAGAAGTGCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T55654 [Download] [View] Facility Assigned ID: TOVED82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence