EST details — SGN-C82578

Search information 
Request: 82578Match: SGN-C82578
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82578Clone name: cLET-20-H7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-20-H7.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295166Length: 406 bp (989 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295166 [] (trimmed) CAAAAGTAGGGTTTTCTTGCAAACACATCGCGCAGCCTCGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACCCAAAGAACTAC
GGCCCTGGCTCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGCTTCCGCAGCAA
TGCCAAGGAAATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAGAAGACATATGG
CATTAGAGCTTTTTGATTTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTGATTTATGTTTTAACTTTTGGAAGTAACTGCTATGTG
AACCTAAGAAAGACTAGCTTTTAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295166] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107580 [Download] [View] Facility Assigned ID: TMEDA40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5