Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E832971

Search information 
Request: 832971Match: SGN-E832971
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C666818Clone name: CC-F01_011_C19.scf
nocartOrdering Not Available
Library Name: irdccfOrganism: Coffea canephora

Tissue: Cherry of different developmental stages
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence Id: SGN-E832971Length: 509 bp (569 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E832971 [] (trimmed) ggctagactaaacagagtaaaacaaaacgctggtgaaaagagcaaagaaaaaccagcagagtcacaagacagctagtttgttcaacatttgaact
[BLAST]  [AA Translate]
Current Unigene builds
[SGN-E832971] SGN-U620076 Coffea canephora Build 3 6 ESTs assembled
[SGN-E832971] SGN-U630434 Coffee species Build 1 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
SGN-ID: SGN-T666907 [Download][View] Facility Assigned ID: CC-F01_011_C19
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: