EST details — SGN-E836451
Search information |
Request: 836451 | Match: SGN-E836451 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C672200 | Clone name: CC-L01_013_E06.scf |
| ||
Library Name: irdccl | Organism: Coffea canephora |
Tissue: Young leaves
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E836451 | Length: 298 bp (612 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E836451 [] (trimmed)
atcgaagtccaaggttttcttagctgaggtcatttgtgtccggacatttctgcagggaacagctaagaaaacgaagtccaaggttttcatttttc
ttaatgctgtatgtattgtgttgatcatatgggagcatgcttatcttattagtacctggctagggtctacccacttatggaatatagattgggat
ttataagcgaaacaatgctgcatctgattcattgtaattttatttatgtgtagacactccaatagttgaatatctcatacatgctgtctgaattg
aggcttttgacct
ttaatgctgtatgtattgtgttgatcatatgggagcatgcttatcttattagtacctggctagggtctacccacttatggaatatagattgggat
ttataagcgaaacaatgctgcatctgattcattgtaattttatttatgtgtagacactccaatagttgaatatctcatacatgctgtctgaattg
aggcttttgacct
Unigenes |
Current Unigene builds | |||||
[SGN-E836451] | SGN-U613672 | Coffea canephora | Build 3 | 5 ESTs assembled | |
[SGN-E836451] | SGN-U639904 | Coffee species | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T672289 [Download][View] | Facility Assigned ID: CC-L01_013_E06 |
Submitter: None | Sequencing Facility: ird |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |