EST details — SGN-E836451

Search information 
Request: 836451Match: SGN-E836451
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C672200Clone name: CC-L01_013_E06.scf
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E836451Length: 298 bp (612 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E836451 [] (trimmed) atcgaagtccaaggttttcttagctgaggtcatttgtgtccggacatttctgcagggaacagctaagaaaacgaagtccaaggttttcatttttc
ttaatgctgtatgtattgtgttgatcatatgggagcatgcttatcttattagtacctggctagggtctacccacttatggaatatagattgggat
ttataagcgaaacaatgctgcatctgattcattgtaattttatttatgtgtagacactccaatagttgaatatctcatacatgctgtctgaattg
aggcttttgacct
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E836451] SGN-U613672 Coffea canephora Build 3 5 ESTs assembled
[SGN-E836451] SGN-U639904 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T672289 [Download][View] Facility Assigned ID: CC-L01_013_E06
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: