EST details — SGN-E84136

Search information 
Request: 84136Match: SGN-E84136
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2167Clone name: cLEC-15-A20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181014 is on microarray TOM1: SGN-S1-1-5.2.17.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2167 [cLEC-15-A20] Trace: SGN-T26625 EST: SGN-E203524 Direction: 5' Facility: TIGR
Clone: SGN-C181014 [TUS-35-N20] Trace: SGN-T193715 EST: SGN-E392389 Direction: 5' Facility: INRA
Clone: SGN-C181014 [TUS-35-N20] Trace: SGN-T193962 EST: SGN-E392636 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E84136Length: 531 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E84136 [] (called/trimmed by facility)
CAGGCTAGTATGGGTAATTTGTCCCATTTTGCCAGTGGAAGTGGAGGTGGTAGTACACCTCTAAACGGTGTCGTTCATGACTCACCTGGTGATAC
ACCTGATCATCCTGCTGCTGCTGGTGGCTCTGTTGATGGTTATGCTTCACAGGATTTTGTTGCTGGTTCTTCATCTAGCCGTGAAAGGAAGAAAG
GGGTTCCCTGGACTGAGGAGGAGCATAGGATGTTTCTACTTGGTTTGCAAAAACTCGGTAAAGGTGATTGGCGTGGAATTGCTCGTAACTATGTG
ATCTCTAGAACGCCCACCCAGGTTGCAAGCCACGCCCAGAAATATTTCATTAGGCAAAGTAATATGTCAAGGAGAAAAAGACGCTCCAGTCTGTT
TGATATTGTTGCTGATGAATCAGGGGACACTCCAATGGTATCGAGGGATTTCCTCGCAGATGATCCTGCACAAGCTGAGATGCAAAGCAACAATC
CGGTGCCTCCTACTCCTGCTGTGGATGAAGAATGTGAATCAATGGGTTCAGCAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T26625 [Download] [View] Facility Assigned ID: TCACF10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence