EST details — SGN-E85712

Search information 
Request: 85712Match: SGN-E85712
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90066Clone name: cLEW-1-I20
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90066 [cLEW-1-I20] Trace: SGN-T112095 EST: SGN-E299865 Direction: 5' Facility: TIGR
Clone: SGN-C191330 [TUS-62-L16] Trace: SGN-T342642 EST: SGN-E541767 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191330 [TUS-62-L16] Trace: SGN-T349478 EST: SGN-E548603 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E85712Length: 625 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E85712 [] (called/trimmed by facility)
TTTACAGAAAGATGAAACAAGAAATTTATGGTGGTACCAATAACAAATGGATAATTACAGCACAACAACAAAGAAGTCAAAAGTGTACATTGTTT
CAAGCTAGAAATAGCTTCATTTTGCTATTATTACTTCTTATTAAACAACATAATCGATAGATAGACAGGAAACAAACTCAAGCATTTTATCACAC
AGTAAAAATAAAAACGAATATCAAAACTAAGGAACAACTTTGTAAGCTTTCACCTTATCAATCCAGGAAATGAAGGCTTTTTGTGAGTTCCGGAA
TCCCAAGAAACCGTGCTCCTTGCTCTTGTTCATAGTATCCAAAGCGCAATCTCCAGAAAGGATAAGATCAACAAACCACCAAACTCCAACCTCCT
CCAATTTAGTAGGCACCAATCCATTCTCCTTCACAATCTCATCCCAAACCGCGCCTTTGTCTTTCATCATCTCTACCAATGTGCATCTCTTCCCT
TCATCAAACTCCGCAGCTTCCAGTCCAAATTGCTCACCCAAAACCTTCCAGAAATGCTTCCACTTGAAAACATCCCCATTGCTCACATTAAACGC
CTCATTCTTGGCATAAAGATCCACTGCAGCCCATATCTGATGCTCGGCAATCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T112095 [Download] [View] Facility Assigned ID: TRDAB58THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence