EST details — SGN-E86780

Search information 
Request: 86780Match: SGN-E86780
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2561Clone name: cLEC-16-G8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173432 is on microarray TOM1: SGN-S1-1-3.2.18.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2561 [cLEC-16-G8] Trace: SGN-T26860 EST: SGN-E204971 Direction: 5' Facility: TIGR
Clone: SGN-C173432 [TUS-16-B22] Trace: SGN-T196888 EST: SGN-E395562 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E86780Length: 578 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E86780 [] (called/trimmed by facility)
GGATGGGGACTTGAGGTCTCAGAGCTTGAGAATCAGCTGAAAACTGCAAAATCTAAGGGTATTAACGTTAGGGCTTTGGCTGTGATCAATCCAGG
CAACCCAACTGGGCAGGTTCTCGCTGAGGCTAACCAACGAGAAATTGTGGAATTCTGCAAGAAAGAAGGCCTTGTTCTTCTGGCGGATGAAGTGT
ATCAGGAAAATGTTTATGTGCCTAAGAAGCAGTTCCACTCATTTAAGAAAGTTGCCCGCTCTATGGGATTTGGAGAAAAGGACATCTCTTTAGTT
TCTTTTCAGTCTGTGTCTAAAGGATTCTATGGAGAGTGTGGAAAGCGAGGAGGTTACATGGAGGTTACTGGATTTAGCCCTGAGATAAGAGAACA
GATATACAAAGTGGCATCTGTCAATCTGTGTTCCAACATTTCTGGTCAGATTCTTGCGAGCCTTGTCATGAGCCCTCCGAAGGTGGGTGATGAAT
CATACGAGTCTTTTGCTGCTGAGAAAGAAGGGATACTTTCATCCTTGGCAAGACGTGCAAAGACACTAGAAGATGCATTCAGTAATTTGGAGGGA
GTAACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T26860 [Download] [View] Facility Assigned ID: TCACJ40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence