EST details — SGN-C88451

Search information 
Request: 88451Match: SGN-C88451
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C88451Clone name: cLET-8-E2
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184673 is on microarray TOM1: SGN-S1-1-2.3.14.8
This clone has been mapped as cLET-8-E2.
Additional sequencing 
Clone: SGN-C184673 [TUS-45-G7] Trace: SGN-T198478 EST: SGN-E397152 Direction: 3' Facility: INRA
Clone: SGN-C184673 [TUS-45-G7] Trace: SGN-T198479 EST: SGN-E397153 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290945Length: 417 bp (638 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290945 [] (trimmed) GAAATTCTTGGAAGTATTAAGCACCGGTATCTGGTAAATCTGCGAGGATATTGCAATTCTCCGACATCAAAGTTGTTGATATATGACTTTTTATC
AGGAGGTAGCCTAGATGAAGTTCTGCACGAGAGATCTGAGCAGTTAGACTGGGGTGCACGGCTGACTGTAATCATGGGAGCTGCAAAAGGGCTGG
CATATTTACATCACGATTGTTCACCTCGAGTAATACACCGTGACATAAAGTCTAGCAACATTTTGCTTGATGGAAACTTTGAGGCTCGAGTATCT
GATTTTGGACTGGCCAAATTACTCGGGGATGAGGAGTCTCACATCACAACAATTGTAGCTGGCACATTTGGGTATTTAGCTCCAGAATACATGCA
GAGTGGTAGGGCTACAGAAAAGACAGATGTTTATAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290945] SGN-U564473 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104341 [Download] [View] Facility Assigned ID: TMEBD25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5