EST details — SGN-E9024

Search information 
Request: 9024Match: SGN-E9024
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20007Clone name: cLED-28-O21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C20007 [cLED-28-O21] Trace: SGN-T55958 EST: SGN-E241480 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E9024Length: 319 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E9024 [] (called/trimmed by facility)
TCAGCTAACAGGAAAAATACCTCATTCATTCGGATGTTTAGCTAAGATAGAGATACTTAATTTGGCACAAAATCAGTTCTACGGAGCTGTACCTG
AACTAGTGTGCAAGCTCTGTAACTTGAAAAATTTGACGTTGAGTTACAATTACTTCAATGAAGTTGGACCGGAATGCAAGAAGTTAATTGAGAAA
AGAGTACTTGATATCAAGACGAATTGCATTCCAGGCTTGCCAATGCAAAGATCAGCAGAGGAATGTGCCTGATTTTTTCTGTAGGCCAAGATCTT
GTCCTGACGAAAAGTCATTGGGATTTGTTCCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T55958 [Download] [View] Facility Assigned ID: TOVEE95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence