Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E93430

Search information 
Request: 93430Match: SGN-E93430
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72130Clone name: cLER-1-E10
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185909 is on microarray TOM1: SGN-S1-1-6.2.7.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72130 [cLER-1-E10] Trace: SGN-T91908 EST: SGN-E280354 Direction: 5' Facility: TIGR
Clone: SGN-C185909 [TUS-48-J19] Trace: SGN-T192552 EST: SGN-E391226 Direction: 5' Facility: INRA
Clone: SGN-C185909 [TUS-48-J19] Trace: SGN-T192801 EST: SGN-E391475 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E93430Length: 657 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E93430 [] (called/trimmed by facility)
GCTTAGAAGTGATTGGATTGCTTAAGTCACACAAAGCTTCTACAACCATATCTATCTACATAACATGATGACATTCATCAATAAATTACAAAGAA
TGGAAATATTGTTACAAACTTTCCTTCAAATTTTACAAAAATTGGCAATTGTGGAGTTGATACACCTTGGATATGGAAATCTGCAAGTCCAAAAT
TATGCTTGTGTAGGCATTGGCGAAGTCGGAGGCTTGAGCTCAGGATAATTGGGATATGGAGAAAGTGGCCTTGTAATTCCAGTTCGTGCTTCTGC
TGTTACTTCTGGTTTTGGAGCTGAACTGATTTCTGGAGTAGACTCGGCAGATACTTCTACCTTGGAAACTGTTTCAACTTTCCCCACACTGCCAC
TAGGTTGTGAAGGTATCGGTGACGTAGGAGGCTTGAGATCAGGATAATTAGGATATGGTGAAAGTGTTTCAACGGATGCTTCTACTTTAGATGAT
GCAGCATCCACCTCGGGAACTGATTCACTTGTCTCTGCAGGTTCAGGCAGATTTTTTCTAGTCACTGGAACAGGAAGAAGAGCCAGCCCTATTTG
CTTGATGTCACCTACAAGCTCCTTTGGAGCAATCTCTTTGGTGAGGAACTCATCAACTTGTTGCAGACTTTGCTTTCGCCTATGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T91908 [Download] [View] Facility Assigned ID: TPRAB29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence