EST details — SGN-E93519

Search information 
Request: 93519Match: SGN-E93519
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72269Clone name: cLER-1-K4
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178610 is on microarray TOM1: SGN-S1-1-1.2.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72269 [cLER-1-K4] Trace: SGN-T92116 EST: SGN-E280562 Direction: 5' Facility: TIGR
Clone: SGN-C178610 [TUS-29-J16] Trace: SGN-T184210 EST: SGN-E371443 Direction: 3' Facility: INRA
Clone: SGN-C178610 [TUS-29-J16] Trace: SGN-T184211 EST: SGN-E371444 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E93519Length: 625 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E93519 [] (called/trimmed by facility)
TGATGATGAAGAGTTGCTTGAGCTTGTTGAGCTGGAGGTAAGAGAGTTATTGTCAAGTTATGAGTTTCCTGGTGATGATATTCCTATTCATTGTG
GGTCTGCCCTTTTGGCTTTAGAGGCTTTAATGGCTAATCCTACTATTAAAAGGGGTGATGATCAATGGGTTGATAAGATTTATAAATTGATGGAC
TCTGTTGATGAATATATTCCTATTCCACAAAGACAAACTGAATTACCTTTCTTGATGGCTATTGAAGATGTGTTTTCTATTACTGGTAGAGGTAC
AGTGGCTACAGGGAGAGTGGAAAGAGGGACTGTTAAGACAGGGGAAATTGTTGATATAGTTGGATTGAAGGACACTAGGAACACTACAGTAACAG
GAGTTGAGATGTTTCAGAAGATATTGGATGAAGCAATGGCAGGAGATAATGTGGGGTTGTTGTTGAGAGGTATTCAAAAGATCGATATTCAAAGA
GGAATGGTGTTGGCAAAACCTGGATCAATTACTCCACACACCAAGTTTGAAGCTTTGGTGTATGTGTTGAAGAAGGAAGAGGGTGGCAGGCATTC
CCCTTTCTTTGCTGGGTATAGGCCACAGTTTTACATGAGAACAACTGATGTGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T92116 [Download] [View] Facility Assigned ID: TPRAB62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence