EST details — SGN-E94014

Search information 
Request: 94014Match: SGN-E94014
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72206Clone name: cLER-1-H3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178560 is on microarray TOM1: SGN-S1-1-3.4.4.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72206 [cLER-1-H3] Trace: SGN-T92152 EST: SGN-E280598 Direction: 5' Facility: TIGR
Clone: SGN-C178560 [TUS-29-H14] Trace: SGN-T184203 EST: SGN-E371436 Direction: 3' Facility: INRA
Clone: SGN-C178560 [TUS-29-H14] Trace: SGN-T184204 EST: SGN-E371437 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E94014Length: 464 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E94014 [] (called/trimmed by facility)
CAACAATATCTCATACCATCAAACACTTACATTTCTCTTGATATAAACACCATGGCAGCTGCTACAATGGCTCTTTCTTCCCCTTCTTTTGCTGG
ACAAGCAGTGAAACTCTCACCATCTGCCTCAGAAATCACAGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGCAAAGTCAGCTCCATCTAGCA
GCCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGTCCATTCTCTGGTGAGTCCCCTAGCTACTTGACCGGTGAATTCCCTGGTGACTATGGG
TGGGACACCGCTGGACTTTCAGCTGACCCTGAGACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCAGATGGGCTATGCTTGGTGCTCT
TGGATGTGTCTTCCCTGAGCTCTTGGCCCGTAATGGTGTCAAGTTTGGTGAGGCTGTCTGGTTCAAGGCTGGATCTCAAATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T92152 [Download] [View] Facility Assigned ID: TPRAC38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence