EST details — SGN-E98619

Search information 
Request: 98619Match: SGN-E98619
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86594Clone name: cLET-43-K14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86594 [cLET-43-K14] Trace: SGN-T111003 EST: SGN-E299262 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E98619Length: 623 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E98619 [] (called/trimmed by facility)
GTCCTGGCGGATATTAGTATCATTTTGCCTGAAGATAAGGGGAAACTGACAGATGTTGGCTTTAGTTTATCGCCTATCTTGGCCTTTTGGACCTT
CTATTTTGAAGGAATGGTGGCCTCCTACTCTATGCTTTTGACTCTGCTGGACTGCTGTACCTTAATTGAACCATGCTGTTTCTTATCAGTTAAGA
GGAACATGACAAATGTCTCTTGAGTGTTATCTTGTTTACCTCTATAATTTATACTTCTCAATGATTTAAAAACAAACATAAAAGATATAAACTCG
AGACGAGAGAGAGGATCGACATGCATAAGATGGCCAAGACTGCTAATAAATCACATCGTGACCGAATTGAAGATTTCAATCAGTACTTGGCAAAC
ATGAGTGAGCACTATGACATTCCCAAAGTTGGCCCTGGCTAATTAAGAACAAATCAGAAATTTGCTGCTGGATCTCCATGTCTCCTTTACAGTTG
TTTCGCGTTAGCATCTGTACTAGCTACTATTTTGCATGTACTCTGTAATTTAGATGTTCCCTTGGTTCGATGGTCTTTGCATGATCATCTTCCTT
CTGAGGCTGAACCTCGCAATGATGTTCTAATGGATGTAAATTTTCAGATTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T111003 [Download] [View] Facility Assigned ID: TMEGN67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence