EST details — SGN-C10715

Search information 
Request: 10715Match: SGN-C10715
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10715Clone name: cLEC-6-A9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183865 is on microarray TOM1: SGN-S1-1-2.1.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183865 [TUS-43-E15] Trace: SGN-T196223 EST: SGN-E394897 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202235Length: 563 bp (662 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202235 [] (trimmed) CAGGTTGACAAACTTCCTGAAGAAATTAATGAAATGAAGATCAGAGATGATAAAGCAGAAAAGGAAATGGAAGCAGCTGTAGTTGACGGGAACGG
AACAGAAAAGGGCCACATCATTGTGACAACTATTGGGGGCAAAAATGGTGAGCCTAAGCAGACCATTAGTTACATGGCCGAGCGTGTTGTTGGAC
AGGGTTCCTTTGGAATTGTGTTTCAGGCCAAATGCCTTGAAACTGGAGAAACTGTGGCAATAAAAAAAGTTCTACAGGATAAGCGATACAAGAAT
CGGGAATTGCAAACAATACGCCTTCTTGACCATCCTAATGTTGTTTCACTGAGACACTGCTTCTTTTCAACCACAGAAAAGGATGAGCTTTATCT
TAATTTGGTTCTTGAATATGTACCTGAGACTGTCTACCGTGTGTTGAGACATTACAGCAAAGCAAACCAACGGATGCCAATGATTTATGTCAAGC
TCTATACATATCAGATTTTCAGAGCTTTGGCTTACATACATGGGATAGGAGTCTGCCACAGGGACATCAAGCCTCAGAATTTACTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202235] SGN-U581958 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23896 [Download] [View] Facility Assigned ID: TCAAU05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5