EST details — SGN-C10775

Search information 
Request: 10775Match: SGN-C10775
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10775Clone name: cLEC-6-D7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172667 is on microarray TOM1: SGN-S1-1-8.3.20.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172667 [TUS-14-C1] Trace: SGN-T195097 EST: SGN-E393771 Direction: 5' Facility: INRA
Clone: SGN-C172667 [TUS-14-C1] Trace: SGN-T195097 EST: SGN-E398899 Direction: 5' Facility: INRA
Clone: SGN-C172667 [TUS-14-C1] Trace: SGN-T195296 EST: SGN-E393970 Direction: 5' Facility: INRA
Clone: SGN-C172667 [TUS-14-C1] Trace: SGN-T195736 EST: SGN-E394410 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202500Length: 445 bp (608 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202500 [] (trimmed) CAGCTTCTTTAGTCATATCTAAGGATGTAGACCTAGACAGCAATAAAAAAACATGGATGAGAATCTACGTACCACGACGAATAATTGCAAATCAT
GACGATGATAAATTGCCAGTTATTTTCTACTATCATGGCGGAGGCTTTGTCTTCTTTCATGTTAATAGTTATGGTTCGGATCTATTTTGTCAACA
ACTATCTGAGAAACTTGACGCGATGATTATTGCCCTTGAATATCGTTTGGCCCCTGAAAATCGACTTCCTGCAGCTTACGATGATGCCATAGATG
GGTTAAATTGGATTAAATCAACTCAAGATGAATGGATTCAAAATTATGCTAATTAGAGTAATGTTTATCTTTTTGGATCAAGTTCTGGTGGAAAC
TTGGCTTACCATGCAGGGCTACGCGTAGCATCTTTTTCAGACAAAGAACTAGAACCAGTAAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202500] SGN-U578033 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24161 [Download] [View] Facility Assigned ID: TCAAW16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5