EST details — SGN-C1089

Search information 
Request: 1089Match: SGN-C1089
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1089Clone name: cLEC-10-M21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184049 is on microarray TOM1: SGN-S1-1-2.1.19.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184049 [TUS-43-M7] Trace: SGN-T196635 EST: SGN-E395309 Direction: 3' Facility: INRA
Clone: SGN-C184049 [TUS-43-M7] Trace: SGN-T196636 EST: SGN-E395310 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201212Length: 390 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201212 [] (trimmed) ATATGGCATTGTCTACCGGGGGAATTTGATTAATGGAACACCTGTAGCTATTAAGAAGCTCCTCAACAATCTAGGCCAAGCTGAGAAAGAGTTCC
AAGTGGAGGTTGAAGCCATTGGCCACGTGCGTCACAAAAATTTGGTCCGCCTTCTAGGATACTGCATTGAAGGAACTCACAGGATGCTGGTTTAC
GAGTATGTCAACAATGGCAATTTGGAACAGTGGCTTCATGGAGCTATGCGACACCACGGGTATCTCACTTGGGAGGCTAGGATGAAGGTTCTCCT
TGGGACAGCTAAAGCTCTTGCGTATTTGCATGAGAATATTGAGCCCAAAGTTGTTCATCGAGACATAAAATCAAGTAATATATTGATTGATGATG
ACTTCAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201212] SGN-U584803 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24799 [Download] [View] Facility Assigned ID: TCABK83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5