EST details — SGN-C109849

Search information 
Request: 109849Match: SGN-C109849
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C109849Clone name: cLPT-1-E15
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: Alias clone SGN-C183041 is on microarray TOM1: SGN-S1-1-2.3.3.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C109849 [cLPT-1-E15] Trace: SGN-T177602 EST: SGN-E366177 Direction: 3' Facility: TIGR
Clone: SGN-C183041 [TUS-41-C7] Trace: SGN-T191469 EST: SGN-E390143 Direction: 3' Facility: INRA
Clone: SGN-C183041 [TUS-41-C7] Trace: SGN-T197471 EST: SGN-E396145 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366176Length: 469 bp (937 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E366176 [] (trimmed) GTTAGTTACAAAGTAGTATAAAGGGAAAGCAAAAGCTAAAGGAAGCTCATTGAGAAATGTCAACTGCTTCCATTAACAATTGCCTTACTCTCTCC
CCTGCTCAAGCTTCCCTTAAGAAACCTACTCGTCCCGTTGCCTTCGCAAGGCTTGGCAACTCTTCTTCTTCTTCTTCTTCTTCTATTCCAAGTCT
CATCAGAAACGAGCCCGTCTTTGCTGCCCCTACTCCCATCATCAACCCCATTGTGAGAGAAGAAATGGCAAAAGAATCCTACGATCAGGCCGTTG
CTGCACTCGAGAAACTCCTCAGCGAGAAAGCAGAACTTGGACCAGTTGCTGCAGCAAGAGTTGACCAGATCACTGCTGAATTGAAATCAGCAGAT
GGCGGCAAGGCATTCGACCCTGTTGAGCACATGAAAGCTGGCTTTATTCATTTCAAGACTGAGAAATATGATACAAACCCAGCCTTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366176] SGN-U578484 Tomato 200607 Build 2 220 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177601 [Download] [View] Facility Assigned ID: TPTAA32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5