EST details — SGN-C117162

Search information 
Request: 117162Match: SGN-C117162
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C117162Clone name: cTOA-5-F9
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182987 is on microarray TOM1: SGN-S1-1-8.1.3.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182987 [TUS-41-A1] Trace: SGN-T1752 EST: SGN-E378615 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182987 [TUS-41-A1] Trace: SGN-T200114 EST: SGN-E398788 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312246Length: 531 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312246 [] (trimmed) GTGGGACACCACAGTTTGGGGGAAGTGCAAAGGCGAAGGATGCATTATGGCAAAGGATGAGTGGTTGTATGGACCAATTGCATTCCATTGTGGTT
GCTGTTTGGCATTTGCAGAGGGTTTTATCGAAGAAAAGAGACCCCTTTACGCATGTCTTGCTGCTTGATGAGGTCATGCAGGAAGGTGATCCGAT
ATTGACGGATCGTGTTTGGGAGGCACTGGGTAAATCTTTTGCTAACCAAATGAAGTCCACTTTCAGCACATCAAGTTTTGTTAAGGAGATATTCA
CTCTTGGATATCCAAAACTCTTCTCTATGTTAGAAAACCTGCTTGAAAGAATTTCACGTGATACAGACGTCAAAGGAGTTCCACCAGCTCTCAGT
TCAGAAGCAAAGGACCAAATGTTATCTTCCATTGAAATATTCCAGACTGCTTTCCTAACCCTCTGTCTGAGCCGTCTTTCAGAACTTGTTAATAC
TGTATTTCCAGTGTCCGGTCGTGGAACTGTTCCTTCAAAAGATCACATAGCAAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312246] SGN-U573461 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124538 [Download] [View] Facility Assigned ID: TFAAS29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5