EST details — SGN-C117173

Search information 
Request: 117173Match: SGN-C117173
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C117173Clone name: cTOA-5-H1
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312249Length: 580 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312249 [] (trimmed) GCACTAACAGCTTTAGCTAATGAAAAGACCCTTGAAACAAGTTTTGTTAGGGATGAAGAAGAACGTCCAAAAGTTGCTTACAATAAATTTAGTGA
CGAAATTCCAGTAATATCGTTGCAAGGTATTGATGATGTTAATGGAAGAAGAAGTGAAATATGTGAGAGAATCGTAAATGCTTGTGAAGATTGGG
GTGTTTTTCAGGTAATTGATCATGGGGTTGATGCTCAATTAATATCACAAATGACAAAATTAGCGAAGGAATTTTTCGAATTGCCTCCTGAGGAA
AAGCTTCGGTTTGACATGTCTGGTGGCAAGAAAGGTGGCTTCATTGTCTCAAGCCACTTACAGGGTGAAGTGGTTCAAGACTGGCGTGAAATAGT
GACTTACTTTTCATACCCCATTCGAGCTAGAGACTATTCTAGATGGCCAGACAAACCACAAGGCTGGATAGGTGTAACTGAGCAATACAGTGAAA
AGTTGATGGATTTGGCTTGCAAATTATTAGAAGTACTATCAGAGGCAATGGGCTTAGAGAAAGAGGCTTTAACCAAGGCATGTGTCGATATGGAC
CAAAAAGTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312249] SGN-U563669 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124541 [Download] [View] Facility Assigned ID: TFAAS37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5