Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C1208

Search information 
Request: 1208Match: SGN-C1208
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1208Clone name: cLEC-11-E22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184061 is on microarray TOM1: SGN-S1-1-6.1.18.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201744Length: 450 bp (742 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201744 [] (trimmed) GGAAAGTTGGTAAGTATGAAGTTGGAAGGACAATTGGAGAAGGAACATTTGCTAAGGTTAAATTTGCTCAGAATACTGAGACAGGTGAAAGTGTC
GCCATGAAAGTCCTCGATCGAAGCACTATCATCAAGCACAAGATGGTTGACCAGATAAAGCAGGAGATATCCATAATGAAGCTTGTTAGACATCC
ATATGTAGTTCGATTACATGAGGTTATAGCAACTCGCACGAAGATCTATATTATCTTGGAATTTATCACAGGCGGGGAACTTTTTGATAAGATAG
TCCACCATGGACGATTAAGTGAGGCCGAGTCTCGAAGATACTTTCAACAATTGATTGATGGAGTTGATTATTGTCACATCAAGGGAGTTTATCAC
AGAGACCTAAAGCCTGAAAATCTTCTGCTAGATTCCCAAGCAAATCTGAAAATATCAGATTTTGGACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201744] SGN-U583917 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25691 [Download] [View] Facility Assigned ID: TCABP35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5