Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C1229

Search information 
Request: 1229Match: SGN-C1229
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1229Clone name: cLEC-11-F3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173029 is on microarray TOM1: SGN-S1-1-6.2.20.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201781Length: 330 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201781 [] (trimmed) AGCAAATTCAAAACCCGAAATTTATAAACTGGGAAGGGGATTACAAAAACCTGAAAACAAAAGTTGAATCGGGACGTTAATTCCGGGTTACCAAA
ATACTGGTGGGCCCATTGAACTTTTTGGGCCCCACCATGCATGGTTTCATCGGCTTCGGCGAATGCCTTTTGGGCCTGGTGGTGGTTCCTACCCA
TTTCCTTTTTGATGTTAACATCATGGAACGGGGGCTCCTCGCACTCGGCCAATTCCATATAAATCATTTGGGTTTTGGGTTTTGGGGGCAATACT
GCTTCAAGGGTCTTGCATTGCTCGAGGGATAATGGGTCGGGGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201781] SGN-U592322 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25728 [Download] [View] Facility Assigned ID: TCABQ26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0242 Quality Trim Threshold: 14.5