EST details — SGN-C125477

Search information 
Request: 125477Match: SGN-C125477
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C125477Clone name: cTOC-1-B16
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C185280 is on microarray TOM1: SGN-S1-1-3.4.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185280 [TUS-46-P14] Trace: SGN-T192286 EST: SGN-E390960 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E325325Length: 483 bp (780 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E325325 [] (trimmed) GCTCTAGAACTGGGATCCCCCGGGCTGCGGATTGTTCAATCTCAATCGATTTATGTTCATGTCTGTTTTGTAATTGTCGTTAATTACAATTGGAT
CAACAGGTGTCTGAGTTTCTCCTCATTTTGATGGGTGCCCTAACAAAGTGGACTTAAAGAAGAACTGCCTTAAAGCTGGGATACTTAAGCATGGA
CCAGGTAAATGGCGAACGATTCTCAAGGATCCAGAATTTAGTGGAGTATTGTGTTTGCGTTCAAATGTAGATCTCAAGGACAAGTGGAGGAACAT
GACTGTAATGGCAAATGGCTGGGGTTCTCGAGAGCAAGCAAGATTGGCTGTCAAAAAGATGAGACAGGCCCCTAAGCAGGATGGGAGTCCTTTGA
CTGATACTACTGCTGCTGATAGTGATGAGGAAGCAGCTGAAACAAGGACTGTCACAACTTCTAGTGGTTCTCCTCAGACACATGGTTCAAAACGA
TCTATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E325325] SGN-U583593 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136063 [Download] [View] Facility Assigned ID: TFCAD08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0145 Quality Trim Threshold: 14.5