EST details — SGN-C128137

Search information 
Request: 128137Match: SGN-C128137
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C128137Clone name: cTOC-4-K11
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182894 is on microarray TOM1: SGN-S1-1-5.1.5.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182894 [TUS-40-M4] Trace: SGN-T187884 EST: SGN-E375990 Direction: 3' Facility: INRA
Clone: SGN-C182894 [TUS-40-M4] Trace: SGN-T187885 EST: SGN-E375991 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E324234Length: 576 bp (949 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E324234 [] (trimmed) TGGCTTGTAATTTTAAGCTATTTCCTTTGTGTTTTTTGATGTTTTTATTGCTAGTGAATAATAATAATAATGTAATATGTCAAGAAGAAGGAAGT
GGAACAAAAAGTGCATTGGTGCCTGCCATGTTTATTTTTGGAGACTCATTGATAGACAATGGCAATAACAATAACTTAGCTTCTTTAGCTAAGGC
TAACTATTTTCCTTATGGAATTGATTTTAATGGTGGCCCTACTGGTCGTTTCTCCAATGGTCTCACTATGGTTGATGTTATTGCTGAATTGCTTG
GACTGCCTTTGACTCCAGCATACTCACAGGTTTCTGGAGACCAAATGAGATTTGGAGTCAATTATGCCTCTGCTGCTGCTGGCATTCTTGATAAT
ACTGGAAGAAATTTTGTAAGGCGCATTCCATTCAATCAGCAAATCACAAATTTTGAGAGCACACTGAACCAATTAAGAAACAATGGAGATGTGGA
AGAGGCACTAGCAAAATCAATTTTCTTTGTTGGAATGGGAAGCAATGACTACCTTAACAATTACCTTATGCCTAATTATAATACAAAAAATCAAT
ATAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E324234] SGN-U577372 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136807 [Download] [View] Facility Assigned ID: TFCAM66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5