Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C130664

Search information 
Request: 130664Match: SGN-C130664
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C130664Clone name: cTOD-1-C7
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C182733 is on microarray TOM1: SGN-S1-1-6.2.5.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182733 [TUS-40-F11] Trace: SGN-T191853 EST: SGN-E390527 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E326008Length: 514 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E326008 [] (trimmed) GCCAACATGTATTTTACATTAACTAACTAGATTTAAAACAAATATCGGACACATATTAAAAAATTAATTTGAAAAAATGATTTTTCAATTTCAGT
TTTCATTTTAAAAGTGAAATTCCATTTTTACCCTTTTTCACCTACTATTTAATTTTCATTTTCTTTTAGAATTTTCTAGTTATGGTGTTTTCCTT
CTTCCTTCCTTCTTTTTAGTATAACAAGATTAATGGAGTCAACAATTTACAGACGAAACATCTGCTCAAAAAACCAACCAGAAAGGCTCAAGCTA
CGACGTTTTTGAGCTGATGGATGAAGAATTCGAGAGGAAGAGGATTGAAGTTAAGGCTATGGAAGCTTTGGGCTGTGGGTTTGATTTTGCTAGCG
ATTTCAGGTTGAAGTTCGTAAAAAGATGTCCAAACGGGGGTAGATTGGTAATTTTGGATGAGAGTAATAGACGGAACGTCGTCATCCCCGGCGGC
GTTACAATTCCCGATGTATCTGAAAATATCCGATGTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E326008] SGN-U569159 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T141718 [Download] [View] Facility Assigned ID: TFDAA16THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5