EST details — SGN-C132481

Search information 
Request: 132481Match: SGN-C132481
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C132481Clone name: cTOD-2-N23
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C183082 is on microarray TOM1: SGN-S1-1-1.4.3.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183082 [TUS-41-D24] Trace: SGN-T195841 EST: SGN-E394515 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E329333Length: 333 bp (526 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E329333 [] (trimmed) GCAACTTAGATATTTTTCTCCATCTGAAGTTCCCAATTATACTAGTTGACACATGGGATTGAGATTGGGGTTAATCTTTGTTGATAAAGTTAGAG
TCTTTAAGCCAAAACAAGTTGAATCAGTATGGAATCACAACTGGGTTTAATTGAAAAATCATTTAATGTTAAATACTCAGATGGGGTTAGAGAAG
CTCTTGATGAATTGCCTGATAGTTTTACAATTACTGATCCCTCTATTTCTGGTCACCCTATTGTTTATGTATCAAGGGGTTTCTTGAAAGTATTT
GGTTATTCAAAGAATGAGGTTTTAGGGAAGAATGGAAGGGTATTTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E329333] SGN-U568979 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T141947 [Download] [View] Facility Assigned ID: TFDAG84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5