EST details — SGN-C139415

Search information 
Request: 139415Match: SGN-C139415
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C139415Clone name: cTOE-7-K6
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: Alias clone SGN-C184570 is on microarray TOM1: SGN-S1-1-1.2.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E337103Length: 558 bp (996 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E337103 [] (trimmed) GGGTGGTGGAAGCAGCAGAGCTCGTAGACAAAGAAGAGGAGAGGATGTTATCCACCCGCTCAAGGTTTCTTTAGAGGATCTTTACAATGGGACAT
CAAAGAAGCTTTCACTATCTCGCAATGTGTTGTGCTCAAAGTTTCTATCAGACAGCTCGGTCCATCCATGATCCAGCAGATGCAGCACCCTTGCA
ATGAGTGTAAGGGTACTGGTGAGATGATCAGTGACAAAGATAGGTGCCCTCAGTGTAAGGGTGAGAAGGTTGTGCAGGAGAAGAAGGTGTTGGAA
GTTCACGTGGAGAAGGGTATGCAGAATGGGCAGAAAGTAACATTTCCAGGCGAGGCAGATGAAGCGCCAGATACCATCACTGGAGACATTGTTTT
TGTCTTGCAACAAAAGGAACATCCTAAGTTCAAGCGAAAGGGAGATGATCTTTTTGTTGAGCACACATTGACCTTGACTGAGGCCCTATGTGGTT
TCCAGTTTGTCTTGACTCACCTAGACAACAGACAGCTGCTCATTAAGTCCCAACCTGGCGAAGTTGTCAAGCCTGATCAGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E337103] SGN-U593335 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148970 [Download] [View] Facility Assigned ID: TAIAZ63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5