Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C14201

Search information 
Request: 14201Match: SGN-C14201
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14201Clone name: cLEC-7-C9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172878 is on microarray TOM1: SGN-S1-1-5.3.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172878 [TUS-14-K20] Trace: SGN-T195399 EST: SGN-E394073 Direction: 3' Facility: INRA
Clone: SGN-C172878 [TUS-14-K20] Trace: SGN-T195399 EST: SGN-E399085 Direction: 3' Facility: INRA
Clone: SGN-C172878 [TUS-14-K20] Trace: SGN-T195694 EST: SGN-E394368 Direction: 5' Facility: INRA
Clone: SGN-C172878 [TUS-14-K20] Trace: SGN-T199532 EST: SGN-E398206 Direction: 3' Facility: INRA
Clone: SGN-C172878 [TUS-14-K20] Trace: SGN-T200219 EST: SGN-E399086 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202087Length: 458 bp (698 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202087 [] (trimmed) CAGGTTATGCCGTCGGGTACAACCTATTTTGTCAAGAAGCTTAATTGGAGTGACAAAATATTTCAGTTGGGAAGCCATGAACTATTTGGGGAAGA
GTTAAGAAATATTGGAAAGCTGAATAATTCGAATGTCATGATTCCACTAGGCTATCTTTTGGCTGCTGATAGTGCTTACCTCTTCTACGAATTTG
CCCCCATTGGCTCGTTATATGATGTTCTTCGTGGTAGCTTGGGCTACTCGTTAGATTGGGCAAGTCGCTACAGCATAGCTATTGGAGTAGCTCAG
GGTTTAGCTTTTCTTCATGGATGTGACAAGGGTCCAATCCTCCTCCTCGACCTTTCCAGCAAGAGCATTCTCTTGAAGTCCCAGAATGAGGCTCA
GATAGGAGACATTGAACTCTACAAGGTGATGGATCCTTCGAAGAGCACAGGCAGCTATTCTGCTGTTGCTGGTTCTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202087] SGN-U573289 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25369 [Download] [View] Facility Assigned ID: TCAAY17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5