EST details — SGN-C14242

Search information 
Request: 14242Match: SGN-C14242
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14242Clone name: cLEC-7-E5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183399 is on microarray TOM1: SGN-S1-1-4.2.2.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183399 [TUS-42-B5] Trace: SGN-T196187 EST: SGN-E394861 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202092Length: 517 bp (711 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202092 [] (trimmed) GTTGTGCAGTCGCTCTACTCCCCCAATTTGAACTCTCTATCGGTGATCTCTTTCTCCGGCGAAGTATTTCGGATTTAAGATCTGCTAGCTTTAAC
AATGGCATCTTCATATCTACCTGCAACCACAGATTCGCTAGCTCAAGCTTCTGAGGCTACAACCCCGTCTGAGGCTATCTCCATTCTCTACCGCA
TCCTTGAGAACCCTTCATCATCTTCTGAGGCCCTAAGGATCAAAGAGCAGGCAATCTTCAATCTCTCTGACCTCCTAAGTCAAGAGAAGAGGGCT
GAGGATCTCCAAAAGCTTCTTGTCCAGTTGCGTCCCTTCTTCTCTTTAATACCCAAGGCAAAAACAGCCAAAATTGTTAATAAAGGAATTGTTGA
TGCGGTGGCTAAGATACCGGGTACATCTGACCTTCAGATTACACTTTGCAAAGATATAGTGCAGTGGGCCCGTTCGGAGAAACGAACTTTCCTTC
GTCAGCGGGTTGAGGCAAAACTTGCAGCTCTTTTGATGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202092] SGN-U571876 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25374 [Download] [View] Facility Assigned ID: TCAAY27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5