EST details — SGN-C14264

Search information 
Request: 14264Match: SGN-C14264
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14264Clone name: cLEC-7-F7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C180812 is on microarray TOM1: SGN-S1-1-7.2.17.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180812 [TUS-35-F10] Trace: SGN-T193687 EST: SGN-E392361 Direction: 3' Facility: INRA
Clone: SGN-C180812 [TUS-35-F10] Trace: SGN-T193688 EST: SGN-E392362 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202017Length: 508 bp (810 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202017 [] (trimmed) GGGAATCTTGTTCTGTTTGATTCGAAGAATGCAACTGTTTGGCAATCGTTTGATCACCCGACTGATGCTTTAGTTCCAGGGCAGAAGTTAGTATC
CGGGATGAAACTAACAGCAAGTGTTTCAACAACAAACTGGACTAAAGGAGGTTTGTTTTCCCTCTCTGCTATGGATAATGGTTTGGTTGCTTTCA
TAGAGTCAAATCCTACCCAAACATACTTTGACGCGACTATTGGTGGGTTGAATCCTAGTGGAGGATCCAATTATGTTAAGTATTTGAATGGAAGC
TTAACTCTCTTCACAAATTCGAGTAGTTCACCCGAGATGGTTCTGGTTTCTATTACTCCAGCATCCTCTGCTCAGTATATGAAACTTGAGTCTAA
CGGACACTTGAAAGTGTACGAGTGGAGAAGTCGATGGAGAGAGGTGGATGATCTCTTAACAGGCTTTCGTGGCGAGTGCAATTACCCTACAGTCT
GTGGAAGATATGGCATTTGCACAATGGGACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202017] SGN-U570753 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25299 [Download] [View] Facility Assigned ID: TCABA28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5