EST details — SGN-C145808

Search information 
Request: 145808Match: SGN-C145808
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C145808Clone name: cTOF-2-O19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181593 is on microarray TOM1: SGN-S1-1-2.2.12.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181593 [TUS-37-F23] Trace: SGN-T194047 EST: SGN-E392721 Direction: 3' Facility: INRA
Clone: SGN-C181593 [TUS-37-F23] Trace: SGN-T199259 EST: SGN-E397933 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E340309Length: 547 bp (941 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E340309 [] (trimmed) GCAGAGGGCAGACGCCGCTGAGCTTAGCGAGGATGGTCTTGAATCAAACACCTAAAGGAAACCCAATGCAATTCGCGAGGAGATTGGGATTAGAG
AATGTGATTAGGGTATTGGAGGATGCAATTTTTGAGTATGCACAAGTGGAGGAGATATTGGAGAAGAGAGGAAAAGGTGAAAATGTTGAGTATTT
AGTGAAATGGAAGGATGGGGAGGATAATGAATGGGTTAAAGCATGGCTGATATCTGAGGATTTGGTGAGAGATTTTGAGGCTGGATTGGAATATG
CAGAGGCAGAGTGCATCTTGGAGAAGAGAGAGGGTGACAACGGGAAAGGCGAGTACTTGGTTAAATGGACTGATATTGAGGAGGCTACTTGGGAA
CCAGAAGAAAATGTTGACCCCCTTCTGATAGAAGATTTTGAAAAAGGTCAACAGAAAGTAGTAAGTTGAATTCATGGTTTCTCTTTTGGCTTGTA
TTTTTCTTTTTCTGTGGTAATATAATGCTCTTTTGTTTTATAAACTATAGTTGTGGTAATGTATGTAATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E340309] SGN-U580115 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153039 [Download] [View] Facility Assigned ID: TOFAE94THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0032 Quality Trim Threshold: 12.5