EST details — SGN-C14706

Search information 
Request: 14706Match: SGN-C14706
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14706Clone name: cLEC-8-C18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C180856 is on microarray TOM1: SGN-S1-1-3.4.17.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200040Length: 373 bp (886 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200040 [] (trimmed) CAGGCACTCCCCATTTTCCAATAACACCATTAGCCTTTCTTTCGTATACTCTCTGCAATATCAAAGCGATAAATAAATCAAATTGATATATCATA
TACATATATAAAGTTATGAAAACTATAATGGCATCGCCACCTGACACAAGCAAAACCACAAAACTAGAGCGCTACAATAGCTATATTCGAAGAGT
TAATAGTACAAAACTCATCGCTGCATCGTCTAAGCTTTTATTTCGTGTCACTTTATTAGTGGCTCTTTTACTTATTTTCTTCTTCACTATAAATT
ACCCTCCGTTAACTTCCGAAAAATCATTCAACAATAATATTCACACCACTACCCATAACCTTCTATCCTCCGCGATTTACGGCGGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200040] SGN-U578129 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25129 [Download] [View] Facility Assigned ID: TCABD21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0160 Quality Trim Threshold: 14.5