Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C14713

Search information 
Request: 14713Match: SGN-C14713
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14713Clone name: cLEC-8-E10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183969 is on microarray TOM1: SGN-S1-1-2.1.18.5
See unigene SGN-U585837 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C183969 [TUS-43-I23] Trace: SGN-T196261 EST: SGN-E394935 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200041Length: 394 bp (889 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200041 [] (trimmed) GGCAGAATGGGCATGGAAGCAACACGGAGAAGGGAACACTGCCATCGATAATATGTTAGATACGGATATCAAAGAAACATGCTACTTGGAAGAAA
TGAAGACAGTGTTCAGACTCGGGCTTATATGCACGAGCAACTTACCTGCGAGCAGGCCTTCCATGAAAGAGATTCTGCAGATACTTCATCGATGC
AAGTCCTTTAGGTATTCTGGAGGAAAATCACCAGATACAGAGTATGATGTTGCTCCTCTCCTTAGCGGGAACAACAGCGAAAAATACATTGCTAG
TTACAAACGTATTAATTCCAATAAGGTAATAGATGATAGTAGTGATGATGGTCTAATAATTTCCAGTGTGTAATATTACAGATGCCAAAGTAATC
TGATCATAGAAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200041] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25130 [Download] [View] Facility Assigned ID: TCABD29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5