| SGN ID: SGN-C148018 | Clone name: cTOF-6-O17 |  | Order Clone |
|
| Library Name: cTOF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants
Microarray: Alias clone
SGN-C181735 is on microarray TOM1: SGN-S1-1-4.4.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E338985 | Length: 181 bp (822 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E338985 [] (trimmed)
GCCCAGTAGCGCCTGGGTGTGAAGTGTCTACAATGGCTGTGTGCACTTCCTCTTTCTTATCTTCTTCTTCTTCATGCCATTCATTGTGCTTTCGT
TTCAATCCCCTTCTCTTCTCCTCCGCAAGTCGTCGTCGTTCTACTCTACCTCTCTCCCGTTCTCGTCTTAGAGGTTATCGCTTTTT
[BLAST] [AA Translate]
| SGN-ID: SGN-T154084 [Download] [View] |
Facility Assigned ID: TOFAU93TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.905 |
Expected Error Rate: 0.0094 |
Quality Trim Threshold: 14.5 |
