Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C15306

Search information 
Request: 15306Match: SGN-C15306
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15306Clone name: cLED-11-I4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175462 is on microarray TOM1: SGN-S1-1-5.3.13.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175462 [TUS-21-G12] Trace: SGN-T1369 EST: SGN-E378513 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235314Length: 561 bp (827 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235314 [] (trimmed) CTCAAGCATTTAAACTGGGTCCTTTTAGCTGCATGATATGTCAAGCACTTCTTTATGAGAGCAGCAGATGTGTGCCCTGTTCACATGTATTCTGC
AAGGCATGTCTCTCCCGCTTTAAGGACTGTCCATTGTGTGGTGCTGATATTGAAAAGATTGAGGCCGATATGAATCTTCAGAATGTTGTCGATCG
CTTTATTGAAGGGCATGCAAGGATTAAGAGGTCTAATAATGAGCAAGAAGATATAGTGGAAAAGAAAACTGTTATATACGAGGATGCATCTTTGG
AGCGTGGAGCTTTCCTGGTTCAACAAGCCATGCGGGCTTTTCGTGCCAATAATATTGATAGTGCAAAATCAAGATTTACTATGTGTGCAGATGAC
ATCAGAGAACAGCTTCAGAGAATGGGGAATACATCAGAGTTGTGCTCACAGCTCGGAGCAGTTCTTGGTATGCTTGGTGACTGCAGTCGAGCTAC
AGGAGATGCTGTATCTGCAGTCGCTTACTTTGAAGAGAGTGCAATTTCCTTTTGAAAGTACCCAAAGATGATGTAGAGATCACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235314] SGN-U577718 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51324 [Download] [View] Facility Assigned ID: TOVBP50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5