EST details — SGN-C15553

Search information 
Request: 15553Match: SGN-C15553
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15553Clone name: cLED-13-E17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175592 is on microarray TOM1: SGN-S1-1-3.4.13.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236341Length: 132 bp (796 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236341 [] (trimmed) GTCCCCTTAGTCTCTGTTATGAAACAATTTTGGCAGCTTGAACCATTTTTCTCTTTTAATTTGTCGCATTGTTCTGCATACGCTTTACTATTGCT
AAAGTTGAGTTGAATGTTTACTTTATTTTGGTGGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236341] SGN-U579575 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51619 [Download] [View] Facility Assigned ID: TOVBW33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.723 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5