SGN ID: SGN-C15553 | Clone name: cLED-13-E17 |  | Order Clone |
|
Library Name: cLED | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis
Microarray: Alias clone
SGN-C175592 is on microarray TOM1: SGN-S1-1-3.4.13.20
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E236341 | Length: 132 bp (796 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E236341 [] (trimmed)
GTCCCCTTAGTCTCTGTTATGAAACAATTTTGGCAGCTTGAACCATTTTTCTCTTTTAATTTGTCGCATTGTTCTGCATACGCTTTACTATTGCT
AAAGTTGAGTTGAATGTTTACTTTATTTTGGTGGCTT
[BLAST] [AA Translate]
SGN-ID: SGN-T51619 [Download] [View] |
Facility Assigned ID: TOVBW33TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.723 |
Expected Error Rate: 0.0036 |
Quality Trim Threshold: 14.5 |