EST details — SGN-C15567

Search information 
Request: 15567Match: SGN-C15567
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15567Clone name: cLED-13-F1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175597 is on microarray TOM1: SGN-S1-1-6.1.13.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175597 [TUS-21-M3] Trace: SGN-T190288 EST: SGN-E377097 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236427Length: 394 bp (998 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236427 [] (trimmed) GAGCTTTCAACAATGGAGGCAGTAGTAGTGGATGCTGGTTCTAAATTTCTCAAAGCTGGTTTCGCTATTCCAGATCAAACTCCTGCTATGGTAAT
ACCAACCCAAATGAAACGCATTGCTGAAGATGATGAAGGTTCCTTGTTTGAGGAGGAGGAAGTGGCTGTGGATCCCATTGAGAGGGGTTTCGTTA
AAGATTGGGATGCAATGGAAGACCTGTTGCATCATGTTCTTTATTCTGGTCTTGGTTGGGAAATTGGAAATGAAGGTCAAATTTTGTTCACTGAC
CCGCTCTGCACTCCCAAGGCTATTAGGGAACAATTGGTGCAGTTGATGTTTGAAACATTCAACATCTCGGGGTTTTATGCCTCTGAGCAGGCAGT
ACTGTCGCTTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236427] SGN-U575973 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51705 [Download] [View] Facility Assigned ID: TOVBY25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5