EST details — SGN-C15734

Search information 
Request: 15734Match: SGN-C15734
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15734Clone name: cLED-13-M21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175675 is on microarray TOM1: SGN-S1-1-8.4.13.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175675 [TUS-21-P9] Trace: SGN-T190558 EST: SGN-E377796 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236536Length: 480 bp (784 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236536 [] (trimmed) TACTTCCGCTAAGATCTTCGTCGCCGGCCACCGTGGACTCGTCGGATCCGCCGTGGTTCGGAAACTTTACCAATTAGGCTGCACAAATCTCATCC
TCCGTACACATTCCGATCTCGATCTCACTAATCAATCCGCGGTCGAATCCTTCTTCGCCGACGAGAAACCTCAATACGTCATCCTCGCAGCCGCG
AAAGTCGGCGGCATACACGCAAACAATACTTACCCAGCTGATTTCATCACTATAAATCTGCAAATCCAAACGAACGTTATCGTTTCATCCTTCAA
TCACAAAGTTCAGAAGCTTCTGTTCCTTGGTTCTTCATGTATTTACCCTAAATTTGCTCCTCAACCAATTCCTGAAAATGCACTTTTAACTGCTC
CTTTGGAACCTACAAATGAATGGTATGCAATTGCGAAAATTGCTGGTATTAAAATGTGTCAAGCTTATAGATTGCAGCATAACTTTGATGCAATT
TCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236536] SGN-U577976 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51814 [Download] [View] Facility Assigned ID: TOVBW83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5