EST details — SGN-C16331

Search information 
Request: 16331Match: SGN-C16331
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C16331Clone name: cLED-16-C15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235947Length: 460 bp (874 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235947 [] (trimmed) CGTCGCACCTCTCCGCCACAACTCTCATCGTCACTACCTCACAACTCTATAAACTTCAGCCACTCACCATATTCGGAATGGGATTGGAGTTCTAG
GATAATGTTTTTGACTTCTCATCTATTTGAAAAATGAACTCACGTCACCTCTTTGGATTTTCTCATCTGAATCTTCACAAATCTAAGAAGACTCT
GAGAAGCTTGTACGTCCTGCACAATGGCGTTTATATGTAGTTCTCATTGTTGTTGTCGTCTTAGAATTTTCTGTTGATGAGGGACCTATAGGGGA
TATAGCCATAACTTATCCACAGGAGTAAAGCTTGAGAAGGAAGATGGTGGTATTCCAAGGGTCAAACAATTTGTAGAGACAAGACGTGCAAATTA
TATGCATGGTTTATTCAGGAAATTACAGAAAGACTTGAGGAGCATTCACGGACTTATTCCTTTGATGAGAATGTAAAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235947] SGN-U571432 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52520 [Download] [View] Facility Assigned ID: TOVCI20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0138 Quality Trim Threshold: 12.5