EST details — SGN-C16922

Search information 
Request: 16922Match: SGN-C16922
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C16922Clone name: cLED-17-P4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175845 is on microarray TOM1: SGN-S1-1-6.3.11.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175845 [TUS-22-G11] Trace: SGN-T180504 EST: SGN-E367890 Direction: 3' Facility: INRA
Clone: SGN-C175845 [TUS-22-G11] Trace: SGN-T180505 EST: SGN-E367891 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238623Length: 269 bp (1056 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E238623 [] (trimmed) GAAAGTCTTACTCGGTGAAAGCTGTTGCTACTGAAGCGGAATCCACTTTTTTTAGCGTCTCGTCATCACACCTTCGTATGCAAGTGGATGGGTGA
AAGTGAAACGCTAGTTTCAAACCTCTTACAAATGGCTCGAGAAAGCGCTCCATCCATTATATTTGTTGCTGAAATTGATTCCTTGCGTGGGCAGC
TAGGAGAAAGACATGAAAGTGAAGCTTCTTGACGTATTAAAACAGAACTCCTTGTGCAGATGCAGGGTGTTGGTCACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238623] SGN-U573760 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53065 [Download] [View] Facility Assigned ID: TOVCP86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0385 Quality Trim Threshold: 14.5