Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C17275

Search information 
Request: 17275Match: SGN-C17275
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17275Clone name: cLED-19-D10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185257 is on microarray TOM1: SGN-S1-1-2.3.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237564Length: 423 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237564 [] (trimmed) GGAACATCCCAAGTTTAAGCGGAAGGGAGATGATCTCTTTGTAGAGCACACCTTGAGCTTAACCGAGGCCCTGTGTGGTTTCCAGTTCATCTTGA
CTCACCTAGATACCAGGCAGCTGATCATCAAGTCCCAACCCGGAGAAGTTGTCAAACCTGATCAATTTAAGGCCATAAATGATGAAGGAATGCCG
ATGTACCAAAGGCCATTTATGAGAGGAAAACTATACATTCACTTCACCGTAGAATTCCCCGACACATTATCCCTCGAGCAATGCAAGAACCTTGA
AGCAGTATTGCCACCAAAACCCAAAACCCAAATGACTGATATGGAATTGGACGAGTGCGAGGAGACCACGTTACATGATGTTAACATCGAAGAGG
AGATGCGTAGGAAGCAGCAACAGGCCCAAGAGGCATACGACGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237564] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53478 [Download] [View] Facility Assigned ID: TOVCX17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0061 Quality Trim Threshold: 12.5