Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C17276

Search information 
Request: 17276Match: SGN-C17276
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17276Clone name: cLED-19-D11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184908 is on microarray TOM1: SGN-S1-1-7.1.12.13
See unigene SGN-U578039 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C184908 [TUS-46-A2] Trace: SGN-T1854 EST: SGN-E378638 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237689Length: 506 bp (820 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237689 [] (trimmed) CAGAGACACACAAGAGGCTCAAAAAGCAACAACTCCAATTGTTGTTACCTCAAATGTACCAAAGTTAATGTGCAAACAAGAAGATGCAACATCAG
CAAAAAGTGATGTTATTGATTCAGATAGCCCACATTACACTGATGGGAATCATTCATCAAATGTATTTGAACAAGAGCCATCTGATTTTTCTCGA
GATGAAGATGACAACCTAAGCAAGAACTTTCTATATTCCCCGAAATCGGAGATCAAATTCAAGCGAATTCATGCAATTTGAGTTTCCAAATTGAA
GATCAACCTTGTTGGTTCTGGCAATATTGAGTTGTTAGGTTACAAGATTTGGCTCGATCCTACTTTAGATCAGTATAAATCCCACAAGTGGAGTC
TGAAGATAATTATATGTACGCACGTACACAAGCAAGCGCACAGTCTTGTCTCTATCCTGTATAGGTAGAGAAACTATTTCTGATAGATCTCGTAC
GACTCTAGTTGTCCAAACTCCAAAAGCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237689] SGN-U578039 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53603 [Download] [View] Facility Assigned ID: TOVCW18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5