EST details — SGN-C17366

Search information 
Request: 17366Match: SGN-C17366
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17366Clone name: cLED-19-H14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184916 is on microarray TOM1: SGN-S1-1-7.1.12.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184916 [TUS-46-A10] Trace: SGN-T198977 EST: SGN-E397651 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237575Length: 490 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237575 [] (trimmed) TAATGCTGAGTGGAAATAACGATAAACACTCACCCTTTGAAGCAATTTAGCTGTTGGGATGGTGTAAACTGGATTTTTGTGTTAACAGTTGCTTT
CTGATGTGTCTCTCGATTCTCTTTCCATTAGTAGATCATCTGGCCTGTAAATGTAGGGGGGAAATAAAGAAATGCGAAGTTAAAGACTTGTTGCT
GAGATTAATAGTTTAATACAATACTCTTTGACAATTAAACAAAATGAAGCTTAAGGAGAGTTTGACTTGGTCATTTAGTTTGACATTAAAGACAT
CAGATATTCTGAATGGGTGCTCAATTTTTTTCTTTTCTTTCTGAACTATAAATGTTTATGGCAGTACTGCTGCGGGTCTTTATATTCTTCTTCGA
GCAGCTGACCGGTTTGCTGCGAACTATAACAAATTTCCTGGACAATTTGATGGTGAGATGGATGAGGATATATCCCGGCTGAAAACTACAGCTGT
TGGCCTACTCAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237575] SGN-U590027 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53489 [Download] [View] Facility Assigned ID: TOVCX43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5