Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C17379

Search information 
Request: 17379Match: SGN-C17379
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17379Clone name: cLED-19-H6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175920 is on microarray TOM1: SGN-S1-1-3.2.11.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175920 [TUS-22-J14] Trace: SGN-T180843 EST: SGN-E368661 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237738Length: 458 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237738 [] (trimmed) TTAAGAGAGAAACAAGGTTCACATCTAAATGCTCGGCCAATGAAATTATCAGTAAGATTGAAGAAGCTGCAAAGCCCCTCGGTTTTGATGTTCAC
AAAAAGAACTACAAGATGAGACTTGAAAATGTCAAAGCTGGAAGAAAAGGGAACCTTAATGTTGCCACTGAGGTATTTCAAGTTGCCCCTTCTCT
TCATATGGTTGAAGTCCGAAAGGCAAAAGGAGATACTTTGGAATTCCACAAGTTCTACAAGAATCTTTCGACTAGTCTAGAGGATGTAGTGTGGA
AAACTGAAGAGGACATGCAAGCTAGGTAGTATTACTACCATGAACTGCAATTGCATAAGCTTTTGCTGGTCCCACAATCTGTGTAAAAAACTTTG
CAACTTGTTTCTTTCTTTCCCTTTTTTTTGTCATTTGGTCTGTTCTTTGTAGTGGGACTTTTTTCTTCCATGAGCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237738] SGN-U580739 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53652 [Download] [View] Facility Assigned ID: TOVCX39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0224 Quality Trim Threshold: 12.5