EST details — SGN-C17576

Search information 
Request: 17576Match: SGN-C17576
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17576Clone name: cLED-1-E23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182282 is on microarray TOM1: SGN-S1-1-1.3.8.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17576 [cLED-1-E23] Trace: SGN-T48485 EST: SGN-E226973 Direction: 3' Facility: TIGR
Clone: SGN-C182282 [TUS-39-C16] Trace: SGN-T194851 EST: SGN-E393525 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E226972Length: 332 bp (786 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E226972 [] (trimmed) GTCAAGAAAAAAAAAATAGAGAGAAATATATATATATTATATACATACATAAAAAAAAAATATTGGGAAAAATGGAGAATAATGTGTATGATAAT
TATAATCATAATAATAATAATAATGTGTTACCAACAGGATATAGATTTTATCCAACAGAAGAAGAATTGGTGGAATTTTATTTAAGAAATAAGCT
TGATGGAAAAAGAGATGATATTCAACGTGTTATACCGAAATGGCAGGAGAAGTGATTAAACATGACACGGAGCAATGGTTTTTCTTCATTCCAAT
TCAAGATAGGGAAGCAAGAGGAGGAAGACCTACTAGACTTACAACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E226972] SGN-U584614 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48484 [Download] [View] Facility Assigned ID: TOVAA36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.868 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5