EST details — SGN-C18156

Search information 
Request: 18156Match: SGN-C18156
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18156Clone name: cLED-22-D8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181112 is on microarray TOM1: SGN-S1-1-3.2.14.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181112 [TUS-36-B22] Trace: SGN-T194081 EST: SGN-E392755 Direction: 5' Facility: INRA
Clone: SGN-C181112 [TUS-36-B22] Trace: SGN-T194185 EST: SGN-E392859 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238254Length: 528 bp (739 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E238254 [] (trimmed) CCTATTACGAGTGGTTTCAATTCAATAAGGAATTTACAGAGTATGAGAATTTTGATAAATGTCTTGAATACATAGAAGAATGTATGATCAAACAT
GGACCTTTCGATGGTCTTCTTGGTTTCTCTCAGGGGGCAATTCTTTCCGGAGCATTGTCGGGGTTGCAGGCTAAGGAAGTGGGACTTACAAAGGC
ATCAAAAATTAAATATCTGATCATAATTGGAGGTGCTAAATTTCGGAATAAATCAGTGGCCGAAAAAGCTTATTCACCAGCAATTGCATGCCCTT
CCGTTCATTTTTTAGGTGAGCAAGATTACCTAAAACAGTATGGGATAGAACTGTTGGAATCATGTGTTGATCCAGTGGTGATTCATCATCCTAGG
GGTCACACTATACCAAGATTCGGTAAACCTCTTTTAATTCAACTTCATTTAAATGTTAATTATATTCTGTGTTGTTAATTAATTCTTCTTCTTCT
TCTTTTTTTTTTCAGATGAGAAAGGATTAGAGAGTGTGCTTAGTTTCATTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238254] SGN-U564822 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54320 [Download] [View] Facility Assigned ID: TOVDJ16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5