EST details — SGN-C1837

Search information 
Request: 1837Match: SGN-C1837
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1837Clone name: cLEC-14-A5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173202 is on microarray TOM1: SGN-S1-1-1.1.20.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173202 [TUS-15-I8] Trace: SGN-T188737 EST: SGN-E375883 Direction: 3' Facility: INRA
Clone: SGN-C173202 [TUS-15-I8] Trace: SGN-T188738 EST: SGN-E375884 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204758Length: 460 bp (844 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204758 [] (trimmed) GAGAATCAAAAAAAGATCAGTAATTTGTTTTTTGTTATGTTATTAATTCTAAGTGTTAGTAGTATTGCCTTTGGTCAATTGAAAACAGACTTTTA
CAAAAATACATGCCCAAATGTTGAGTCATTAGTTCGTTCTGCTGTTAGACTGAAATTTCAACAGACTTTTGTTACGGCTCCAGCGACTCTCCGAC
TCTTTTTTTCATGATTGCTTTGTTCGGGGTTGTGATGCATCGATGCTATTGTCATCACCAAATGGAAAAGCAGAGAAGGACCATCCAGATAATCT
TTCATTAGCTGGTGATGGATTTGATACTGTTGTCAAAGCCAAAGCAGCTGTGGATAGTGACTCTAAATGTCGTAACAAAGTATCTTGTGCTGATA
TTTTAGCTTTGGCTACTAGAGAAGTTGTTGCTATGACTGGAGGCCCATTTTATCCGGTGGAGTTGGGCCGTCGTGATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204758] SGN-U585063 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26374 [Download] [View] Facility Assigned ID: TCACA03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5