EST details — SGN-C1913

Search information 
Request: 1913Match: SGN-C1913
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1913Clone name: cLEC-14-E18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173242 is on microarray TOM1: SGN-S1-1-1.2.19.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173242 [TUS-15-J24] Trace: SGN-T188951 EST: SGN-E375337 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204811Length: 449 bp (867 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204811 [] (trimmed) GGATCGAATTAAACAAGCTGAGAAAAAGAAGAGGCGCTTAGAGAAAGCCTTGGCCACTTCAGCTGCCATCCGTTCTGAACTGGAAAAGAAGAAGC
AGAAGAAGAAAGAAGAACAACAAAGGCTTGATGAACAGGGTGCCGCGATTGCTGAAGCAGTTGCACTTCAGGTTTTACTTGGCGAAGATACAGAT
GATTCATGCAAGCTACTCCTAAAGAAGGAAGAAGGATGGAACACGTGGGATCTTAACAGCAGTTTTGACTTCTTCGTGGGCAGAGGAAGACCCAT
GCTTCCGCGCCAAGACTCTTCAACATACTATTCAGTTGAAGGAGCAGACTGGGTTTCTGGTGCAAGCGGGTACAGATGCATGTCGAATGAGTGGG
GAAATTCCGAGTGGATGGTTTCATCTGAAACTTGGGTAAGGGATGATATTAACCATCAATACTTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204811] SGN-U584690 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26427 [Download] [View] Facility Assigned ID: TCACB33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5