EST details — SGN-C20129

Search information 
Request: 20129Match: SGN-C20129
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20129Clone name: cLED-29-G12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184344 is on microarray TOM1: SGN-S1-1-3.1.16.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184344 [TUS-44-I14] Trace: SGN-T198181 EST: SGN-E396855 Direction: 3' Facility: INRA
Clone: SGN-C184344 [TUS-44-I14] Trace: SGN-T199960 EST: SGN-E398634 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239803Length: 430 bp (684 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239803 [] (trimmed) ACTGGAGGAATTTTAATCCTGCACAAGATGAAGGAAAAGGCATGTTTTATGGCTTCCATGCCAGACTCACCAGATACAAGAGGCAAGGGCGGAGC
ATCAAAGCGGATCACTCATGGTTCCCACCTGGTGAAGGGAAAGTCTAATCACGCGATGGAAGATTGTTTAGTTTGTGAGTTTAAGCAAGTCCATA
ACAACGATTTGGGACTATTCGCAATCTATGATGGACATATGGGCCATGATGTAACAAACTACTTGCAGACACATTTGTTTAACAATATTTTGAAA
GAGCATGACGTTTGGACGGATACTGTGAATGCAACTCGTAGAGCTTATCATAGTACAGACAGAGACATTCTGGCAAAAGCATTCTAATTGGGAAA
AGGAGGGTCAACTGCAGTTACTGGATTGCTGATAAATAGTCCAACACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239803] SGN-U567601 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56091 [Download] [View] Facility Assigned ID: TOVEJ42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5