EST details — SGN-C20194

Search information 
Request: 20194Match: SGN-C20194
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20194Clone name: cLED-29-K11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184348 is on microarray TOM1: SGN-S1-1-7.1.16.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184348 [TUS-44-I18] Trace: SGN-T198184 EST: SGN-E396858 Direction: 3' Facility: INRA
Clone: SGN-C184348 [TUS-44-I18] Trace: SGN-T198185 EST: SGN-E396859 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239912Length: 504 bp (743 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239912 [] (trimmed) GAGATCTTTGCAAACATCATAAATTCTCGAAAACGTACAGGCAAGGCAGAGAATGATATGTTACAATGCTTCATTGACTCAAAGTACAAAGATGG
ACGGCCAACAACAGAGGGTGAGATCACAGGTCTTCTGATTGCTGCTCTTTTCGCTGGGCAGCACACCAGTTCGATCACTTCCACTTGGACAGGGT
CATACCTCCTCACCAACGACAAGTACATGTCGGCTGTTGTAGATGAACAGAAGAATCTGATGAAGAAACACGGGAATAAGGTTGATCACGATATC
CTTTCCGAGATGGAAGTCCTCTACAGATGCATAAAGGAAGCCCTCAGACTCCATCCTCCACTGATAATGCTTCTGCGTAGTTCACATAGCGAATT
CAGTGTTACAACCAGAGAAGGAAAAGAGTATGACATTCCCAAGGGACATATCGTTGCAACCTCACCTGCTTTTGCAAACAGGCTGCCACATATCT
TCAAGAATCCAGATACTTACGACCCTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239912] SGN-U583117 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56200 [Download] [View] Facility Assigned ID: TOVEI66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5