EST details — SGN-C20801

Search information 
Request: 20801Match: SGN-C20801
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20801Clone name: cLED-30-L22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176155 is on microarray TOM1: SGN-S1-1-8.4.11.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176155 [TUS-23-D9] Trace: SGN-T181345 EST: SGN-E368418 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242685Length: 600 bp (839 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E242685 [] (trimmed) CAGGGGCCTTCTGCCTGTTTGTGCTTTAAGTTTCTTGTTTTTGCTGTTTAGCTACAAAATAAGCAAATATGATGTTCTAGCTTGCCATTTTACAC
ATAGAAGATGGCGTTTCGTTCTGAGGAAACACAAACGGAGGATTACCTTTTCAAGATTGTTTTGATTGGTGATTCAGCTGTTGGGAAATCAAATT
TGCTTGCTAGATTTGCTCGTGATGAATTCTATCCCAACTCAAAATCAACAATTGGAGTAGAGTTCCAGACCCAAAAGCTGGACATAAATGGGAAG
GAGGTCAAAGCGCAGATATGGGACACAGCAGGTCAAGAACGGTTTAGGGCAGTAACTTCTGCATATTACAGAGGTGCAGTTGGAGCTCTTCTGGT
TTATGATATTAGTAGACGGCTAACTTTCGAAAATATTGGTCGATGGCTTAATGAACTTCAGACTCATTCTGACATGAACGTGGTTACAATACTCG
TTGGAAATAAATCTGATCTCAAAGATGCGAGGGAGGTGACAACAGCTGAAGGCAAATCCCTAGCAGAGGCACAAGGTCTATTCTTTATAGAAACA
TCAGCTTTGGATTCTTCAAATGTAACTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242685] SGN-U564984 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56615 [Download] [View] Facility Assigned ID: TOVEP71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5